LUMC0020iCTRL06, FLB6
LUMCi028-A
General
Donor Information
General Donor Information |
|
| Sex | female |
| Ethnicity | Caucasian |
Phenotype and Disease related information (Donor) |
|
| Diseases | No disease was diagnosed.
|
Karyotyping (Donor) |
|
| Has the donor karyotype been analysed? |
No
|
Other Genotyping (Donor) |
|
| Is there genome-wide genotyping or functional data available? |
No
|
External Databases (Donor) |
|
| BioSamples | SAMEA6673736 |
Ethics
| Has informed consent been obtained from the donor of the embryo/tissue from which the pluripotent stem cells have been derived? | No |
| Was the consent voluntarily given? | No |
| Has the donor been informed that participation will not directly influence their personal treatment? | No |
| Can you provide us with a copy of the Donor Information Sheet provided to the donor? | No |
| Do you (Depositor/Provider) hold the original Donor Consent Form? | No |
| If you do not hold the Donor Consent Form, do you know who does? | No |
| Alternatives to consent are available? | Yes |
| Alternatives to consent | General LUMC hospital rules for surgical waste materials for research according to Dutch law |
| Alternative consent approval number | |
| Please indicate whether the data associated with the donated material has been pseudonymised or anonymised. | anonymised |
| Does consent explicitly allow the derivation of pluripotent stem cells? | No |
| Does consent prevent CELLS DERIVED FROM THE DONATED BIOSAMPLE from being made available to researchers anywhere in the world? | No |
| How may genetic information associated with the cell line be accessed? | No information |
| Will the donor expect to receive financial benefit, beyond reasonable expenses, in return for donating the biosample? | No |
| Has a favourable opinion been obtained from a research ethics committee, or other ethics review panel, in relation to the Research Protocol including the consent provisions? | Yes |
| Name of accrediting authority involved? | LUMC Medical Ethical Commitee |
| Approval number | Umbrella protocol P13.080 |
| Has a favourable opinion been obtained from a research ethics committee, or other ethics review panel, in relation to the PROPOSED PROJECT, involving use of donated embryo/tissue or derived cells? | Yes |
| Name of accrediting authority involved? | LUMC Medical Ethical Commitee |
| Approval number | Umbrella protocol P13.080 |
| Do you have obligations to third parties in regard to the use of the cell line? | Yes |
| Please describe: | No commercial use allowed by SeV provider |
| Are you aware of any further constraints on the use of the donated embryo/tissue or derived cells? | Yes |
| Further constraints on use | No commercial use allowed by SeV provider |
| For generation of the cell line, who was the supplier of any recombined DNA vectors or commercial kits used? | Mahito Nakanishi, PhD, Research Center for Stem Cell Engineering National Institute of Advanced Industrial Science and Technology (AIST) |
| Are you aware of any constraints on the use or distribution of the cell line from the owner or any parties identified in the query above? | No |
iPSC Derivation
General |
|
| Source cell type | |
| Passage number reprogrammed | p3 |
Reprogramming method |
|
| Vector type | Non-integrating |
| Vector | Sendai virus |
| Genes | |
| Is reprogramming vector detectable? |
No |
| Methods used |
RT-PCR
|
| Notes on reprogramming vector detection | Primer sequences used for detection: GCAGCTCTAACGTTGTCAAA/CCTGGAGCAAATTCACCATGA |
| Files and images showing reprogramming vector expressed or silenced | |
| Vector map | |
Vector free reprogramming |
|
Other |
|
| Selection criteria for clones | The selected clone has been manually picked based on the typical embryonic stem cell-like morphology |
| Derived under xeno-free conditions |
No |
| Derived under GMP? |
No |
| Available as clinical grade? |
No |
iPSC Culture Conditions
| Surface coating | Vitronectin |
| Feeder cells |
No |
| Passage method |
Enzyme-free cell dissociation
EDTA
|
| O2 Concentration | 20 % |
| CO2 Concentration | 5 % |
| Medium | Essential 8™ |
| Has Rock inhibitor (Y27632) been used at passage previously with this iPSC line? | No |
| Has Rock inhibitor (Y27632) been used at cryo previously with this iPSC line? | No |
| Has Rock inhibitor (Y27632) been used at thaw previously with this iPSC line? | Yes |
iPSC Characterisation
Analysis of undifferentiated iPSCs
| Marker | Expressed | Immunostaining | RT-PCR | Flow Cytometry | Enzymatic Assay | Expression Profiles |
| NANOG |
Yes |
|||||
| SSEA-4 |
Yes |
|
||||
| TRA 1-81 |
Yes |
|||||
| POU5F1 (OCT-4) |
Yes |
Morphology pictures
FLB6_P9_4X.tif
Brightfield image hiPSC colony_lower magnification
FLB6_P9_10X.tif
Brightfield image hiPSC colony_higher magnification
Differentiation Potency
In vitro spontaneous differentiation
| Marker | Expressed |
| AFP |
Yes |
Morphology
Endodermal marker AFP_IF.pdf
Immunostaining for endodermal marker AFP
In vitro spontaneous differentiation
| Marker | Expressed |
| PECAM1(CD31) |
Yes |
Morphology
Mesodermal marker CD31_IF.pdf
Immunostaining for mesodermal marker CD31
In vitro spontaneous differentiation
| Marker | Expressed |
| TUBB3 |
Yes |
Morphology
Ectodermal marker TBB3_IF.pdf
Immunostaining for ectodermal marker TBB3
Microbiology / Virus Screening |
|
| Mycoplasma | Negative |
Genotyping
Karyotyping (iPSC Line) |
|
| Has the iPSC line karyotype been analysed? |
Yes
|
Other Genotyping (iPSC Line) |
|

Login to share your feedback, experiences or results with the research community.