
Cell Line

hPSCreg Name LUMCi028-A
Alternative name(s)
Cell line type Human induced pluripotent stem cell (hiPSC)
Last update 29th January 2020
User feedback
No feedback available yet.

Login to share your feedback, experiences or results with the research community.


Generator Leiden University Medical Center (LUMC)
Owner Leiden University Medical Center (LUMC)
Derivation country Netherlands

External Databases

BioSamples SAMEA6673735
Cellosaurus CVCL_ZA25
CLO CLO_0100740

General Information

* Is the cell line readily obtainable for third parties?
Research: allowed
Clinical: not allowed
Commercial: not allowed

Donor Information#

General Donor Information

Sex female
Ethnicity Caucasian

Phenotype and Disease related information (Donor)

Diseases No disease was diagnosed.

Karyotyping (Donor)

Has the donor karyotype been analysed?

Other Genotyping (Donor)

Is there genome-wide genotyping or functional data available?

External Databases (Donor)

BioSamples SAMEA6673736


Has informed consent been obtained from the donor of the embryo/tissue from which the pluripotent stem cells have been derived? No
Was the consent voluntarily given? No
Has the donor been informed that participation will not directly influence their personal treatment? No
Can you provide us with a copy of the Donor Information Sheet provided to the donor? No
Provide contact information of the holder of the original Donor Information Sheet: N/A
Do you (Depositor/Provider) hold a copy of the SIGNED Donor Consent Form? No
If you do not hold the SIGNED Donor Consent Form, do you know who does? No
If you do not hold the SIGNED Donor Consent Form, have you obtained a copy of the unsigned Donor Consent Form from the holder? No
Alternatives to consent are available? Yes
Alternatives to consent General LUMC hospital rules for surgical waste materials for research according to Dutch law
Alternative consent approval number
Please indicate whether the data associated with the donated material has been pseudonymised or anonymised. anonymised
Does consent explicitly allow the derivation of pluripotent stem cells? No
Does consent prevent CELLS DERIVED FROM THE DONATED BIOSAMPLE from being made available to researchers anywhere in the world? No
How may genetic information associated with the cell line be accessed? No information
Will the donor expect to receive financial benefit, beyond reasonable expenses, in return for donating the biosample? No
Has a favourable opinion been obtained from a research ethics committee, or other ethics review panel, in relation to the Research Protocol including the consent provisions? Yes
Name of accrediting authority involved? LUMC Medical Ethical Commitee
Approval number Umbrella protocol P13.080
Has a favourable opinion been obtained from a research ethics committee, or other ethics review panel, in relation to the PROPOSED PROJECT, involving use of donated embryo/tissue or derived cells? Yes
Name of accrediting authority involved? LUMC Medical Ethical Commitee
Approval number Umbrella protocol P13.080
Do you have obligations to third parties in regard to the use of the cell line? Yes
Please describe: No commercial use allowed by SeV provider
Are you aware of any further constraints on the use of the donated embryo/tissue or derived cells? Yes
Further constraints on use No commercial use allowed by SeV provider
For generation of the cell line, who was the supplier of any recombined DNA vectors or commercial kits used? Mahito Nakanishi, PhD, Research Center for Stem Cell Engineering National Institute of Advanced Industrial Science and Technology (AIST)
Are you aware of any constraints on the use or distribution of the cell line from the owner or any parties identified in the query above? No

hIPSC Derivation#


Source cell type
skin fibroblast
Passage number reprogrammed p3

Reprogramming method

Vector type Non-integrating
Vector Sendai virus
Is reprogramming vector detectable?
Methods used
Notes on reprogramming vector detection Primer sequences used for detection: GCAGCTCTAACGTTGTCAAA/CCTGGAGCAAATTCACCATGA
Files and images showing reprogramming vector expressed or silenced
Vector map

Vector free reprogramming


Selection criteria for clones The selected clone has been manually picked based on the typical embryonic stem cell-like morphology
Derived under xeno-free conditions
Derived under GMP?
Available as clinical grade?

Culture Conditions#

Surface coating Vitronectin
Feeder cells
Passage method Enzyme-free cell dissociation
O2 Concentration 20 %
CO2 Concentration 5 %
Medium Essential 8™
Has Rock inhibitor (Y27632) been used at passage previously with this cell line?
Has Rock inhibitor (Y27632) been used at cryo previously with this cell line?
Has Rock inhibitor (Y27632) been used at thaw previously with this cell line?


Analysis of Undifferentiated Cells
Marker Expressed Immunostaining RT-PCR FACS Enzymatic Assay Expression Profiles
TRA 1-81
POU5F1 (OCT-4)
Morphology pictures
Brightfield image hiPSC colony_lower magnification
Brightfield image hiPSC colony_higher magnification
Differentiation Potency
Ont Id: UBERON_0000925
In vitro spontaneous differentiation
Marker Expressed
Endodermal marker AFP_IF.pdf
Immunostaining for endodermal marker AFP
Ont Id: UBERON_0000926
In vitro spontaneous differentiation
Marker Expressed
Mesodermal marker CD31_IF.pdf
Immunostaining for mesodermal marker CD31
Ont Id: UBERON_0000924
In vitro spontaneous differentiation
Marker Expressed
Ectodermal marker TBB3_IF.pdf
Immunostaining for ectodermal marker TBB3

Microbiology / Virus Screening

Mycoplasma Negative


Karyotyping (Cell Line)

Has the cell line karyotype been analysed?
46, XX
Passage number: p27
Karyotyping method: G-Banding

Other Genotyping (Cell Line)