The cell line is not submitted yet.
(only basic data is shown)
General
Cell Line |
|
hPSCreg Name | RIi002-A-1 |
Cell line type | Human induced pluripotent stem cell (hiPSC) |
Last update | 5th April 2022 |
Notes | In this clone, the exon 2 is completely deleted in one allele. Monoallelic exon 2 deletion of BMPR2 has been observed in pulmonary arterial hypertension in several reports (for example Hiepen et al 2019 PMID: 31826007 and Frump et al 2013 PMID: 24224048). The exon 2-deleted product seems to skip the nonsense-mediated decay (NMD), which leads to the presence of a shorter version of protein and usually a more severe clinical outcome. To delete exon 2 of BMPR2, we used two sgRNAs, one in the intron before and one intron after, so a part of the introns are also deleted together with exon 2 (sgRNA1: GTGAGAATAATTTGAGTACG; shRNA3: AAACACAGTCATTTCAGGTA) |
User feedback | |
Provider |
|
Generator | Max Planck Institute for Heart and Lung Research (MPIHLR) |
Owner | Embryonic Stem Cell Biology |
Distributors | |
External Databases |
|
BioSamples | SAMEA13928828 |
Cellosaurus | CVCL_C1W1 |
Wikidata | Q114312785 |
General Information |
|
* Is the cell line readily obtainable for third parties? |
No |
Subclone of |
hIPSC Derivation
General |
|
The source cell information can be found in the parental cell line
RIi002-A.
|
Login to share your feedback, experiences or results with the research community.