The cell line is not submitted yet.
(only basic data is shown)

General#

Cell Line

hPSCreg Name
RIi002-A-1
Cell line type Human induced pluripotent stem cell (hiPSC)
Last update 5th April 2022
Notes In this clone, the exon 2 is completely deleted in one allele. Monoallelic exon 2 deletion of BMPR2 has been observed in pulmonary arterial hypertension in several reports (for example Hiepen et al 2019 PMID: 31826007 and Frump et al 2013 PMID: 24224048). The exon 2-deleted product seems to skip the nonsense-mediated decay (NMD), which leads to the presence of a shorter version of protein and usually a more severe clinical outcome. To delete exon 2 of BMPR2, we used two sgRNAs, one in the intron before and one intron after, so a part of the introns are also deleted together with exon 2 (sgRNA1: GTGAGAATAATTTGAGTACG; shRNA3: AAACACAGTCATTTCAGGTA)
User feedback
No feedback available yet.

Login to share your feedback, experiences or results with the research community.

Provider

Generator Max Planck Institute for Heart and Lung Research (MPIHLR)
Owner Embryonic Stem Cell Biology
Distributors

External Databases

BioSamples SAMEA13928828

General Information

* Is the cell line readily obtainable for third parties?
No
Subclone of

hIPSC Derivation#

General

The source cell information can be found in the parental cell line RIi002-A.