iso01LUMC0153iPKP03, LUMC0153iPKP03corr#22

General#

Cell Line

hPSCreg Name
LUMCi027-A-1
Alternative name(s)
iso01LUMC0153iPKP03, LUMC0153iPKP03corr#22
Cell line type Human induced pluripotent stem cell (hiPSC)
Last update 25th January 2021
User feedback
No feedback available yet.

Login to share your feedback, experiences or results with the research community.

Provider

Generator Leiden University Medical Center (LUMC)
Owner Leiden University Medical Center (LUMC)
Distributors
Derivation country Netherlands

External Databases

Cellosaurus CVCL_ZA19
BioSamples SAMEA8073006
CLO CLO_0103260

General Information

Publications
Projects
* Is the cell line readily obtainable for third parties?
Yes
Research: allowed
Clinical: not allowed
Commercial: not allowed
Subclone of

Donor Information#

General Donor Information

Sex female
Ethnicity Caucasian

Phenotype and Disease related information (Donor)

Diseases A disease was diagnosed.
arrhythmogenic right ventricular dysplasia 9 (primary disease)
The donor is a carrier of a disease-associated mutation and affected.
Synonyms
  • ARVD9
  • ARVC9
  • arrhythmogenic right ventricular cardiomyopathy 9
  • familial arrhythmogenic right ventricular dysplasia 9
show more synonyms
Genetic variants
PKP2 (target)
12p11.21
Heterozygous
Sequencing data showing the presence of the heterozygous mutation in PKP2 c.2013delC (NM_004572.3; p.K672Rfs, NP_004563.2) in the LUMCi027-A
PKP2 sequencing_LUMCi027-A.pdf
Sequencing PKP2 c.2013delC

Karyotyping (Donor)

Has the donor karyotype been analysed?
No

Other Genotyping (Donor)

Is there genome-wide genotyping or functional data available?
No

External Databases (Donor)

BioSamples SAMEA6724120

Ethics#

Also have a look at the ethics information for the parental line LUMCi027-A .
For generation of the cell line, who was the supplier of any recombined DNA vectors or commercial kits used? Mahito Nakanishi, PhD, Research Center for Stem Cell Engineering National Institute of Advanced Industrial Science and Technology (AIST)
Are you aware of any constraints on the use or distribution of the cell line from the owner or any parties identified in the query above? No

hIPSC Derivation#

General

The source cell information can be found in the parental cell line LUMCi027-A.
Passage number reprogrammed p3

Reprogramming method

Vector type Non-integrating
Vector Sendai virus
Genes
Is reprogramming vector detectable?
No
Methods used
RT-PCR
Notes on reprogramming vector detection Primer sequences used for detection: GCAGCTCTAACGTTGTCAAA/CCTGGAGCAAATTCACCATGA
Files and images showing reprogramming vector expressed or silenced
Vector map

Vector free reprogramming

Other

Selection criteria for clones Selection based on typical embryonic stem cell-like morphology
Derived under xeno-free conditions
No
Derived under GMP?
No
Available as clinical grade?
No

Culture Conditions#

Surface coating Vitronectin
Feeder cells
No
Passage method Enzyme-free cell dissociation
EDTA
O2 Concentration 20 %
CO2 Concentration 5 %
Medium Essential 8™
Has Rock inhibitor (Y27632) been used at passage previously with this cell line?
Yes
Has Rock inhibitor (Y27632) been used at cryo previously with this cell line?
Yes
Has Rock inhibitor (Y27632) been used at thaw previously with this cell line?
Yes

Characterisation#

Analysis of Undifferentiated Cells
Marker Expressed Immunostaining RT-PCR FACS Enzymatic Assay Expression Profiles
NANOG
Yes
SOX2
Yes
POU5F1 (OCT-4)
Yes
SSEA-4
Yes
Morphology pictures
Brightfield image hiPSC colony
Differentiation Potency
Endoderm
Ont Id: UBERON_0000925
In vitro directed differentiation
Marker Expressed
FOXA2
Yes
SOX17
Yes
Morphology
Endodermal marker FOXA2_IF.pdf
Immunostaining for endodermal marker FOXA2
Endodermal marker SOX17_IF.pdf
Immunostaining for endodermal marker SOX17
Mesoderm
Ont Id: UBERON_0000926
In vitro directed differentiation
Marker Expressed
NCAM
Yes
Brachyury T
Yes
Morphology
Mesodermal marker NCAM_IF.pdf
Immunostaining for mesodermal marker NCAM
Mesodermal marker Brachyury T_IF.pdf
Immunostaining for mesodermal marker T (Brachyury T)
Ectoderm
Ont Id: UBERON_0000924
In vitro directed differentiation
Marker Expressed
PAX6
Unknown
TUBB3
Unknown
Morphology
Ectodermal marker PAX6_IF.pdf
Immunostaining for ectodermal marker PAX6
Ectodermal marker TUBB3_IF.pdf
Immunostaining for ectodermal marker TUBB3

Microbiology / Virus Screening

Mycoplasma Negative

Genotyping#

Karyotyping (Cell Line)

Has the cell line karyotype been analysed?
Yes
46, XX
Passage number: p25

Other Genotyping (Cell Line)

Genetic Modification#

Disease/phenotype related modifications
arrhythmogenic right ventricular dysplasia 9
Synonyms
  • ARVD9
  • ARVC9
  • arrhythmogenic right ventricular cardiomyopathy 9
  • familial arrhythmogenic right ventricular dysplasia 9
show more synonyms
Genetic modifications
PKP2 (target)
Isogenic modification
12p11.21
Heterozygous
Sequencing data showing the correction of the heterozygous mutation in PKP2 c.2013delC (NM_004572.3; p.K672Rfs, NP_004563.2) in the LUMCi027-A-1 isogenic line, using the CRISPR/Cas9 technology
Repaired
PKP2 sequencing_LUMCi027-A-1.pdf
PKP2 sequencing_LUMCi027-A-1