iso01LUMC0153iPKP03, LUMC0153iPKP03corr#22
LUMCi027-A-1
General
Donor Information
General Donor Information |
|
| Sex | female |
| Ethnicity | Caucasian |
Phenotype and Disease related information (Donor) |
|
| Diseases | A disease was diagnosed.
|
Karyotyping (Donor) |
|
| Has the donor karyotype been analysed? |
No
|
Other Genotyping (Donor) |
|
| Is there genome-wide genotyping or functional data available? |
No
|
External Databases (Donor) |
|
| BioSamples | SAMEA6724120 |
Ethics
Also have a look at the ethics information for the parental line
LUMCi027-A
.
| For generation of the cell line, who was the supplier of any recombined DNA vectors or commercial kits used? | Mahito Nakanishi, PhD, Research Center for Stem Cell Engineering National Institute of Advanced Industrial Science and Technology (AIST) |
| Are you aware of any constraints on the use or distribution of the cell line from the owner or any parties identified in the query above? | No |
hIPSC Derivation
General |
|
|
The source cell information can be found in the parental cell line
LUMCi027-A.
|
|
| Passage number reprogrammed | p3 |
Reprogramming method |
|
| Vector type | Non-integrating |
| Vector | Sendai virus |
| Genes | |
| Is reprogramming vector detectable? |
No |
| Methods used |
RT-PCR
|
| Notes on reprogramming vector detection | Primer sequences used for detection: GCAGCTCTAACGTTGTCAAA/CCTGGAGCAAATTCACCATGA |
| Files and images showing reprogramming vector expressed or silenced | |
| Vector map | |
Vector free reprogramming |
|
Other |
|
| Selection criteria for clones | Selection based on typical embryonic stem cell-like morphology |
| Derived under xeno-free conditions |
No |
| Derived under GMP? |
No |
| Available as clinical grade? |
No |
Culture Conditions
| Surface coating | Vitronectin |
| Feeder cells |
No |
| Passage method |
Enzyme-free cell dissociation
EDTA
|
| O2 Concentration | 20 % |
| CO2 Concentration | 5 % |
| Medium | Essential 8™ |
| Has Rock inhibitor (Y27632) been used at passage previously with this cell line? | Yes |
| Has Rock inhibitor (Y27632) been used at cryo previously with this cell line? | Yes |
| Has Rock inhibitor (Y27632) been used at thaw previously with this cell line? | Yes |
Characterisation
Analysis of Undifferentiated Cells
| Marker | Expressed | Immunostaining | RT-PCR | Flow Cytometry | Enzymatic Assay | Expression Profiles |
| NANOG |
Yes |
|||||
| SOX2 |
Yes |
|||||
| POU5F1 (OCT-4) |
Yes |
|||||
| SSEA-4 |
Yes |
Morphology pictures
Brightfield image hiPSC colony
Differentiation Potency
In vitro directed differentiation
Morphology
Endodermal marker FOXA2_IF.pdf
Immunostaining for endodermal marker FOXA2
Endodermal marker SOX17_IF.pdf
Immunostaining for endodermal marker SOX17
In vitro directed differentiation
| Marker | Expressed |
| NCAM |
Yes |
| Brachyury T |
Yes |
Morphology
Mesodermal marker NCAM_IF.pdf
Immunostaining for mesodermal marker NCAM
Mesodermal marker Brachyury T_IF.pdf
Immunostaining for mesodermal marker T (Brachyury T)
In vitro directed differentiation
| Marker | Expressed |
| PAX6 |
Unknown |
| TUBB3 |
Unknown |
Morphology
Ectodermal marker PAX6_IF.pdf
Immunostaining for ectodermal marker PAX6
Ectodermal marker TUBB3_IF.pdf
Immunostaining for ectodermal marker TUBB3
Microbiology / Virus Screening |
|
| Mycoplasma | Negative |
Genotyping
Karyotyping (Cell Line) |
|
| Has the cell line karyotype been analysed? |
Yes
|
Other Genotyping (Cell Line) |
|
Genetic Modification
| Disease/phenotype related modifications |
|
Login to share your feedback, experiences or results with the research community.